xavaoneillx xavaoneillx

03-06-2018
Physics

contestada

Answer either one or both questions! Must explain and show work to receive brainliest!

Answer either one or both questions Must explain and show work to receive brainliest class=

Respuesta :

jduck02p8y2mq jduck02p8y2mq

03-06-2018

F x L = W x X whereW=weight is total load = 80, L is length from fulcrum which is the unknown and what we are solving for. x= length we know. and F equals 50 force we know. So (W*X)/F=LL equals 64

Answer Link

Otras preguntas

Num supermercado, 200g de queijo e 300g de presunto custam juntos R$ 9,00. Renan resolveu comprar 400g de queijo e 400g de presunto e pagou R$ 14,00. Qual o pre

The accounts receivable credit column of the cash receipts journal isA.posted by individual amounts only at the end of the month. B. not posted.C. posted in su

What climate conditions led to the formation of the world’s earliest known civilization? a. wet and tropical b.wet and cold c.dry and cold d.dry and semiarid

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

QuICk AnsWEr ThIs QuESTIon

Angles A and B are two acute angles in a triangle. If sin A equals cosine B, what can you conclude about the triangle?

Please answer these questions 20 points!!!! 20 points!!!!! I will give brainliest to the first person to answer !!!!

What the volume of a prism

You randomly choose a marble from a jar. The jar contains 3 red marbles, 10 blue marbles, 8 green marbles, and 4 yellow marbles. Find the probability of choosin

What's the difference between biotic and abiotic?