strangerthings1983 strangerthings1983

04-06-2018
Mathematics

contestada

PLEASE HELP! ( will give brainliest)

PLEASE HELP will give brainliest class=

Respuesta :

ilikebooksalot ilikebooksalot

04-06-2018

To answer your question, the mode is 90 :)

Answer Link

Otras preguntas

Why were senators able to amass more power and influence than congressmen during the gilded age?

What is the distance between points (-42, 63) and (-39, 67)?

1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession

The actions of the pueblo indians at santa fe in 1680 can best be described as:

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

Which of the following props should you suggest to clients with tight muscles and physical restrictions? A. Pillow and an exercise block B. Exer

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following do scientists think will probably cause Earth's next ice age?

what is x? using the picture below and directions

who invented the glass harmonica