seakawksLOB
seakawksLOB seakawksLOB
  • 01-04-2016
  • Mathematics
contestada

17-2c for c = 7 what is the answer

Respuesta :

SmarticalParticals
SmarticalParticals SmarticalParticals
  • 01-04-2016
Simply substitute the 7 in for c in the equation then solve...

17 - 2c =
17 - 2 (7) =
17 - 14 = 3
Answer Link
garydesir1
garydesir1 garydesir1
  • 01-04-2016

17-2c for c=7

Replace c by its number

17-2(7)

17-14

= 3


I hope that's help !


Answer Link

Otras preguntas

How many moles of methane will react to form 3.2 moles of carbon dioxide?
All of the following are infectious microorganisms (as opposed to microorganisms causing food-borne intoxication)except for: A. Colstridium botulinum (botulism)
PLEASE HELP ASAP!!! When would you use a line graph? A. if the data is given as data pairs B. if the data is numerical C. to compare categories D. to com
Gustavo and Aiden are walking due west through the forest when they happen upon an angry grizzly bear. Gustavo runs away 23^\circ23 ∘ 23, degrees north of east
What is the slope indicated in the table below
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
Which organism will have DNA most similar to the bird? Why?
I need it fast it’s quiz
calculate the volume occupied by 0.15mol ofCO2​
What was one difference between the Knights of Labor (KOL) and the American Federation of Labor (AFL)? A. The KOL admitted women and African Americans. B. The K