mtaylor5165 mtaylor5165
  • 01-06-2019
  • Mathematics
contestada

Solve for an angle in right triangles.

Solve for an angle in right triangles class=

Respuesta :

ErinFranklin2177
ErinFranklin2177 ErinFranklin2177
  • 01-06-2019

C is 90°fare and height

Answer Link
Laylow120
Laylow120 Laylow120
  • 01-06-2019

Answer:

[tex] \sin(x) = \frac{4}{6 } \\ x = arcsin( \frac{2}{3} ) \\ x = 41.81 \: degrees [/tex]

Step-by-step explanation:

Google search inverse trigonometry geometry for an explanation

answer technically should say

measure of angle A equals 41.81 degrees

there should be the letter m in front of the angle symbol.

Answer Link

Otras preguntas

Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
what rule does static electricity follow
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
How did the mountains in Greece contribute to the rise of city-states?
Compliant is to stubborn as excited is to
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.