jajajajsjsjsjsja jajajajsjsjsjsja

01-04-2020
Mathematics

contestada

Calcula el área de la zona comprendida entre los dos cuadrados.

Calcula el área de la zona comprendida entre los dos cuadrados class=

Respuesta :

cang3530 cang3530

01-04-2020

Area= lado^2

como el largo de los lados de todos los cuadrados son igual, puedes multiplicar por el mismo.

Es decir 6cm x 6cm= 36cm^2

Answer Link

Otras preguntas

. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm

Which of the following can be a cause of social change?

A mutation that occurs in the gametes of an organism will most likely be transferred where

Why would a signature item, such as distinctive button or tag, be considered a need even if it was not essential to the item’s function? -f someone powerful in

The long-reigning absolutist king of france, __________, portrayed himself as the "sun king."

Why does an insertion mutation usually cause more defects during protein synthesis than a point mutation? a. insertion mutations only occur during transcription

1. Read the paragraph below. When Tyrese dropped his crutches and limped to the starting block, the audience froze. Then the starter’s signal sounded, and the s

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

In which sentence does the underlined noun clause function as the object of a preposition. Our group sends whoever requests information a newsletter and a link

Which american colony was established in the 1660s as a haven for quakers?