jaimesalejandro55 jaimesalejandro55
  • 02-03-2021
  • Mathematics
contestada

A tree casts a shadow that is 125 ft. At the same time, a 4ft tall person
casts a shadow that is 5 ft. What is the height of the tree from the ground?

A tree casts a shadow that is 125 ft At the same time a 4ft tall person casts a shadow that is 5 ft What is the height of the tree from the ground class=

Respuesta :

Wenning0419
Wenning0419 Wenning0419
  • 02-03-2021

Answer:

100ft

Step-by-step explanation:

H over S

H over 125 then 4 over 5

cross Multiply would give you

5H = 500

500 ÷ 5 is 100

Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Where did middle names come from
Why were the committees of correspondence powerful?
the bombing of Hiroshima and Nagasaki resulted in
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea