spinellisaxa spinellisaxa

04-03-2021
Mathematics

contestada

helllpppp me i will make you the brillientist

helllpppp me i will make you the brillientist class=

Respuesta :

trinity148065 trinity148065

04-03-2021

28.26 i used a calculator

Answer Link

Otras preguntas

At 5 P.M., the total snowfall is 2 centimeters. At 9 P.M., the total snowfall is 12 centimeters. What is the mean hourly snowfall? Write your answer in simplest

Find the equation of the line with slope -3 that passes through the point (-5,3)

At the city museum, child admission is $5.70 and adult admission is $9.50. on Friday, 155 tickets were sold for a total sales of $1255.90. how many child ticket

Clay offers to pay Diane $50 for a golf lesson for Ewan. They agree to meet on Friday to exchange the cash for the lesson. These parties have made a bilateral

What was the purpose of Miller and Urey's experiment? A. To find out if prokaryotes have genetic information B. To find out if the protists evolved from the euk

Matrix question is so confusing

Which of these BEST describes someone voting a "straight ticket"? A) Flynn votes for the candidate he believes to be the most honest. B) Marie takes into accoun

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

how can i arrange these animals in different groups of classification and what title can I give ? German Shepherd, Great Dane, parrot, Irish setter, canar

which ion is typically present in soil with a high acidity