jmalonetaylor
jmalonetaylor jmalonetaylor
  • 02-06-2021
  • Mathematics
contestada

Please help if you dont mind?

Please help if you dont mind class=

Respuesta :

heypeoplelol heypeoplelol
  • 02-06-2021

Answer:

choice A

Step-by-step explanation:

Answer Link
broalijahby broalijahby
  • 02-06-2021
The answer is A.........
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
People and societies in which they live lie outside the biosphere.
There are 36 ways two dice can land: six ways for the first die and six ways for the second die. in how many of those ways does at least one of the dice show a
Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90
The moon can always be seen from every part of the earth. This is a(n) ____________statement. a. Qualified c. Neither of these b. Absolute d. Both of these
Each unit on the map represents 5 miles. What is the actual distance from Oceanfront to Seaside? Question 3 options: about 10 miles about 40 miles about 50 mile
How are logos, pathos, and ethos I used in an argument
What is the value of x?
What did Theodore Roosevelt do before he was elected president at the age of 42?
Which type of oscillation would most likely produce an electromagnetic wave?