kanyealexander0r458 kanyealexander0r458

03-06-2021
History

contestada

According to James Baldwin, what was one important result of the development of black English?

Respuesta :

zjsvpxzjjz zjsvpxzjjz

03-06-2021

the unity of African people with American and they were given an identity as people.

Answer Link

Otras preguntas

please help me with this

The Triangular Trade benefited the Southern Colonies by: A. Allowing England to establish colonies in Africa incorrect answer. B. Reducing the travel time betwe

I need help on this please

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What are the two types of end notes in APA?

What was the direct result of the event Chairman Khrushchev refers to in this statement?

Name the coordinates of the points on the graph. F _____ G_____ H_____ M_____ P_____

The first digit of the unlock code is 6 greater than the second digit. It is also 3 times greater than the second digit . The third digit is four less than the

Which of these statements is an example of hownew technologies are changing education?

An 84-year-old woman with history of atrial fibrillation presents to the emergency department with right arm weakness that began acutely 2 hours earlier, accomp