memequeenn memequeenn

01-02-2017
Mathematics

contestada

57 + 4 x 4 -12. using the same expression add parentheses so that the value of the expression is 232

57 4 x 4 12 using the same expression add parentheses so that the value of the expression is 232 class=

Respuesta :

Аноним Аноним

01-02-2017

(57+4)x4-12=232
61x4-12
244-12

Answer Link

Otras preguntas

When the term F.O.B. shipping point is used, title passes when the

Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability

please help if you know, thanks!

Definition: an event that is made up of two or more outcomes is called ____.

During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, and some become part of the stomach, etc.

x 2 • x 5 answer quick

A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

When reading for subject content, prereading activities are not important. Please select the best answer from the choices provided True or False

if 2^x-4=4a^x-6 what is the value of a