carterleslie131 carterleslie131
  • 03-02-2017
  • Mathematics
contestada

If Logx (1 / 8) = - 3 / 2, then x is equal to
A. - 4
B. 4
C. 1 / 4
D. 10

Respuesta :

amillion08 amillion08
  • 03-02-2017
the answer to this  is b
Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
A true fisherman the reader can surmise that fisherman are ?
Write the equation of the line that is parallel to the line 2x + 5y = 15 and passes through the point (-10, 1)
(1)/(5)x +3=2x-24 Anwser please kitten
the new number, 200, is 400 less then the original number. What us the approximate percent change? •the percent change is approximately .6% •the percent change
35) Which of the following span the phospholipids bilayer, usually a number of times? A) transmembrane proteins B) integral proteins C) peripheral proteins D) i
HELP!!!!! I AM DESPERATE!!!!!
OZ Find 4 consecutive odd integers such that the sum of the first and the last is the same as 9 less than the third
Can anyone help me out with questions 2, 3, & 4?
write a three paragraph reflection on the story the lottery