chloeehaack9993 chloeehaack9993
  • 03-11-2017
  • Biology
contestada

Activity of a muscle spindle is to ____ as activity of the golgi tendon organ is to ____.

Respuesta :

quenbarr quenbarr
  • 14-11-2017
The muscle spindle activity is to contraction as of the Golgi tendon organ is to inhibition of contraction. The first blank space answer is contraction while the second blank answer is inhibition of contraction. The muscle spindle is the sensory receptors with the body of the muscle that can detect changes in the length of this muscle.
Answer Link

Otras preguntas

Solve the equation -10 + 3x + 5x = -56 ? ??
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
Write expression using the distributive property to find the product of 7 times 63
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Do you think then solid can undergo convection
2ln(5x)=8 solve for x
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a